algorithms imagej fiji schneider (Oxford Instruments)
Oxford Instruments is a verified supplier 
Oxford Instruments manufactures this product 
99
Structured Review
Oxford Instruments
algorithms imagej fiji schneider
Algorithms Imagej Fiji Schneider, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej+schneider/Imaris/pm41689806-832-115-121
Average 99 stars, based on 44474 article reviews
Algorithms Imagej Fiji Schneider, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej+schneider/Imaris/pm41689806-832-115-121
Average 99 stars, based on 44474 article reviews
algorithms imagej fiji schneider - by Bioz Stars,
2026-11
99/100 stars
Images
Related Articles
other:Article Title: APOE3ch alters microglial response and suppresses Aβ-induced tau seeding and spread. Article Snippet: Article APOE3ch alters microglial response and suppresses Ab-induced tau seeding and spread Software:Article Title: Microglial lipid phosphatase SHIP1 limits complement-mediated synaptic pruning in the healthy developing hippocampus. Article Snippet: In brief Inpp5d, which encodes the lipid phosphatase SHIP1, is a risk gene for Alzheimer’s disease, but its role in brain development has been poorly studied.. Matera, Compagnion et al. demonstrate that Inpp5d is expressed in microglia during early postnatal brain development, where it limits synaptic pruning in a complement-dependent manner, and that its perturbation during brain development has long-lasting effects on cognitive function. Article Title: Neuraminidase 1 regulates neuropathogenesis by governing the cellular state of microglia via modulation of Trem2 sialylation. Article Snippet: R: CCTGGTTTAGCTGATAGCGGAT Integrated DNA Technologies N/A .. F: TGCATCAGTGACGGTAAACCA R: TTCTTCAGCCGTGCAACAATC Integrated DNA Technologies N/A IL-1a F: CGAAGACTACAGTTCTGCCATT R: GACGTTTCAGAGGTTCTCAGAG Integrated DNA Technologies N/A IL-1b F: GCAACTGTTCCTGAACTCAACT R: ATCTTTTGGGGTCCGTCAACT Integrated DNA Technologies N/A Table continued in Table S6 Software and Article Title: Altered GM1 catabolism affects NMDAR-mediated Ca 2+ signaling at ER-PM junctions and increases synaptic spine formation in a GM1-gangliosidosis model. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays FD Rapid GolgiStainTM Kit FD NeuroTechnologies PK401 Deposited data ER-PM junction proteomics data This study PXD042994 Experimental models: Cell lines HeLa ATCC CRM-CCL-2 HEK293T ATCC CRL-3216 Experimental models: Organisms/strains B6.129P2(FVB)-Glb1tm1Adz/J (b-Gal / ) Jackson Labs Strain #:037063 Software and algorithms ImageJ Schneider et al.74 https://imagej.net/ij/download.html Imaris Analysis Software Oxford Instruments https://imaris.oxinst.com/products/ imaris-for-neuroscientists IMOD software Kremer et al.75 https://bio3d.colorado.edu/imod/ download.html SerialEM Software David Mastronarde76 https://bio3d.colorado.edu/SerialEM/ Other Pansorbin Cells Millipore Sigma 507858-1GM .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays FD Rapid GolgiStainTM Kit FD NeuroTechnologies PK401 Deposited data ER-PM junction proteomics data This study PXD042994 Experimental models: Cell lines HeLa ATCC CRM-CCL-2 HEK293T ATCC CRL-3216 Experimental models: Organisms/strains B6.129P2(FVB)-Glb1tm1Adz/J (b-Gal / ) Jackson Labs Strain #:037063 Software and Article Title: PI3K/AKT signaling controls ICM maturation and proper epiblast and primitive endoderm specification in mice. Article Snippet: Article PI3K/AKT signaling controls ICM maturation and proper epiblast and primitive endoderm specification in mice Article Title: Protocol for three-dimensional whole-mount imaging of the vascular network in the intestinal muscle. Article Snippet: Schrenk et al., STAR Protocols 5, 103170 September 20, 2024 a 2024 Three-dimensional (3D) imaging of vascular networks is essential for the investigation of vascular patterning and organization.. Here, we present a step-by-step protocol for the 3D visualization of the vasculature within whole-mount preparations of the mouse intestinal muscularis propria layer.. We then detail the quantitative analysis of the resulting images for parameters such as vessel density, vessel diameter, the number of endothelial cells, and proliferation. Real-time Polymerase Chain Reaction:Article Title: Microglial lipid phosphatase SHIP1 limits complement-mediated synaptic pruning in the healthy developing hippocampus. Article Snippet: In brief Inpp5d, which encodes the lipid phosphatase SHIP1, is a risk gene for Alzheimer’s disease, but its role in brain development has been poorly studied.. Matera, Compagnion et al. demonstrate that Inpp5d is expressed in microglia during early postnatal brain development, where it limits synaptic pruning in a complement-dependent manner, and that its perturbation during brain development has long-lasting effects on cognitive function. Live Cell Imaging:Article Title: Microglial lipid phosphatase SHIP1 limits complement-mediated synaptic pruning in the healthy developing hippocampus. Article Snippet: In brief Inpp5d, which encodes the lipid phosphatase SHIP1, is a risk gene for Alzheimer’s disease, but its role in brain development has been poorly studied.. Matera, Compagnion et al. demonstrate that Inpp5d is expressed in microglia during early postnatal brain development, where it limits synaptic pruning in a complement-dependent manner, and that its perturbation during brain development has long-lasting effects on cognitive function. Imaging:Article Title: Microglial lipid phosphatase SHIP1 limits complement-mediated synaptic pruning in the healthy developing hippocampus. Article Snippet: In brief Inpp5d, which encodes the lipid phosphatase SHIP1, is a risk gene for Alzheimer’s disease, but its role in brain development has been poorly studied.. Matera, Compagnion et al. demonstrate that Inpp5d is expressed in microglia during early postnatal brain development, where it limits synaptic pruning in a complement-dependent manner, and that its perturbation during brain development has long-lasting effects on cognitive function. Article Title: Protocol for three-dimensional whole-mount imaging of the vascular network in the intestinal muscle. Article Snippet: Schrenk et al., STAR Protocols 5, 103170 September 20, 2024 a 2024 Three-dimensional (3D) imaging of vascular networks is essential for the investigation of vascular patterning and organization.. Here, we present a step-by-step protocol for the 3D visualization of the vasculature within whole-mount preparations of the mouse intestinal muscularis propria layer.. We then detail the quantitative analysis of the resulting images for parameters such as vessel density, vessel diameter, the number of endothelial cells, and proliferation. Reverse Transcription:Article Title: PI3K/AKT signaling controls ICM maturation and proper epiblast and primitive endoderm specification in mice. Article Snippet: Article PI3K/AKT signaling controls ICM maturation and proper epiblast and primitive endoderm specification in mice SYBR Green Assay:Article Title: PI3K/AKT signaling controls ICM maturation and proper epiblast and primitive endoderm specification in mice. Article Snippet: Article PI3K/AKT signaling controls ICM maturation and proper epiblast and primitive endoderm specification in mice RNA Sequencing:Article Title: PI3K/AKT signaling controls ICM maturation and proper epiblast and primitive endoderm specification in mice. Article Snippet: Article PI3K/AKT signaling controls ICM maturation and proper epiblast and primitive endoderm specification in mice Saline:Article Title: Protocol for three-dimensional whole-mount imaging of the vascular network in the intestinal muscle. Article Snippet: Schrenk et al., STAR Protocols 5, 103170 September 20, 2024 a 2024 Three-dimensional (3D) imaging of vascular networks is essential for the investigation of vascular patterning and organization.. Here, we present a step-by-step protocol for the 3D visualization of the vasculature within whole-mount preparations of the mouse intestinal muscularis propria layer.. We then detail the quantitative analysis of the resulting images for parameters such as vessel density, vessel diameter, the number of endothelial cells, and proliferation. Electron Microscopy:Article Title: Protocol for three-dimensional whole-mount imaging of the vascular network in the intestinal muscle. Article Snippet: Schrenk et al., STAR Protocols 5, 103170 September 20, 2024 a 2024 Three-dimensional (3D) imaging of vascular networks is essential for the investigation of vascular patterning and organization.. Here, we present a step-by-step protocol for the 3D visualization of the vasculature within whole-mount preparations of the mouse intestinal muscularis propria layer.. We then detail the quantitative analysis of the resulting images for parameters such as vessel density, vessel diameter, the number of endothelial cells, and proliferation. Dissection:Article Title: Protocol for three-dimensional whole-mount imaging of the vascular network in the intestinal muscle. Article Snippet: Schrenk et al., STAR Protocols 5, 103170 September 20, 2024 a 2024 Three-dimensional (3D) imaging of vascular networks is essential for the investigation of vascular patterning and organization.. Here, we present a step-by-step protocol for the 3D visualization of the vasculature within whole-mount preparations of the mouse intestinal muscularis propria layer.. We then detail the quantitative analysis of the resulting images for parameters such as vessel density, vessel diameter, the number of endothelial cells, and proliferation. Microscopy:Article Title: Protocol for three-dimensional whole-mount imaging of the vascular network in the intestinal muscle. Article Snippet: Schrenk et al., STAR Protocols 5, 103170 September 20, 2024 a 2024 Three-dimensional (3D) imaging of vascular networks is essential for the investigation of vascular patterning and organization.. Here, we present a step-by-step protocol for the 3D visualization of the vasculature within whole-mount preparations of the mouse intestinal muscularis propria layer.. We then detail the quantitative analysis of the resulting images for parameters such as vessel density, vessel diameter, the number of endothelial cells, and proliferation. |